Kolokium Departemen Biologi FMIPA IPB: Della Y Windi

Della Yuniar Windi ( G34090107), Achmad Farajallah, Dyah Perwitasari. 2012. Deteksi Polimorfisme Gen calpain (CAPN1) dan calpastatin (CAST) pada Sapi Lokal (sapi Madura) dengan Metode PCR-RFLP dan PCR-SSCP. Makalah Kolokium Departemen Biologi FMIPA IPB, Bogor

PENDAHULUAN

Latar Belakang

Sapi merupakan ternak utama sebagai penghasil daging dan susu. Beberapa bangsa sapi lokal di Indonesia antara lain sapi bali, sapi madura, sapi aceh, sapi pesisir, dan sapi peranakan ongole. Sapi bali merupakan keturunan langsung dari banteng sedangkan sapi madura merupakan hasil persilangan sapi zebu yang berpunuk (Bos indicus) dengan banteng (Bos sondaicus). Sapi madura dicirkan dengan tubuh berukuran sedang, pertulangan bagus, berotot bagi sapi jantan, tanduk kecil ke atas atau ke samping, kaki dan teracak kuat, gumba berkembang baik pada jantan, terdapat lingkaran putih di sekitar moncong (Huitema 1986; Adrial 2010).

Sapi Madura merupakan sapi tipe dwiguna (pedaging dan pekerja). Salah satu parameter yang biasanya digunakan konsumen untuk memilih daging yang berkualitas adalah tingkat keempukan daging atau meat tenderness. Dua enzim yang berperan terhadap keempukan daging adalah enzim calpastatin yang dihasilkan oleh gen CAST dan enzim calpain yang dihasilkan oleh gen calsium activated neural protease-1 (CAPN1) (Koohmaraie et al. 1995). Gen CAPN1 terletak pada kromosom nomor 29, calpain merupakan enzim proteolytic terkait dengan ion kalsium (Ca2+), yang ada dalam dua bentuk, yaitu μ-calpain dan m-calpain. Calpain berfungsi untuk mendegradasi protein-protein sel otot (myofibril) di dalam jaringan otot (Goll et al. 1992). Gen CAST pada ternak sapi terletak pada kromosom nomor 7 (Bishop et al. 1993). Calpastatin ini merupakan inhibitor spesifik terhadap fungsi μ-calpain dan m-calpain.  Peningkatan aktifitas calpastatin menyebabkan terjadinya pertambahan masa otot (hyperthropy) dan penurunan keempukan daging.

Metode yang umum digunakan dalam analisis adanya SNP (single nucleotide polymorphism) antara lain PCR-RFLP (restriction fragment length polymorphism) dan PCR-SSCP (single strand conformation polymorphism). Metode PCR-RFLP bisa mendeteksi mutasi jika situs restriksi mengalami perubahan susunan basa, metode PCR-SSCP dapat mendeteksi perubahan pada satu basa, tetapi tidak dapat diketahui basa yang berubah (Hayashi 1991). Berdasarkan penelitian terdahulu, gen CAPN1 yang menggunakan marker CAPN316 mengalami polimorfisme di exon 9 yang disebabkan substitusi cytosin dengan guanin (C/G) (Page et al. 2002), sedangkan pada gen CAST dengan marker UOGCAST mengalami polimorfisme di intron 5 yang disebabkan substitusi cytosin dengan guanin (C/G) (Schenkel et al. 2006).

Informasi penanda molekuler dengan gen CAPN1 dan CAST dapat menjadi sangat bermanfaat untuk identifikasi sapi dengan nilai genetik yang tinggi untuk keempukan dagingnya dan proses seleksi dapat diaplikasikan pada hewan-hewan yang muda bahkan sebelum lahir. Tetapi keempukan merupakan ciri yang kompleks untuk program pemuliaan ternak karena evaluasinya juga bergantung pada bagaimana cara hewan tersebut dipotong.

Tujuan

Penelitian ini bertujuan untuk mendeteksi polimorfisme gen calpain (CAPN1) dan calpastatin (CAST) pada sapi Madura.

Waktu dan Tempat

            Penelitian ini akan dilaksanakan pada bulan Februari 2013 – September 2013 di bagian Fungsi Hayati dan Perilaku Hewan Departemen Biologi,  IPB.

BAHAN DAN METODE

Sampel Darah Sapi Madura

Darah dari sapi Madura yang disimpan dalam alkohol merupakan sampel koleksi Dr. Dyah Perwitasari.

Ekstraksi dan Isolasi DNA

Ekstraksi dan isolasi DNA akan dilakukan dari sel-sel darah sapi yang disimpan dalam alkohol menggunakan DNA Extraction Kit for animal blood (Geneaid).

 

Amplifikasi gen CAPN1 dan CAST dengan Polymerase Chain Reaction (PCR)

Untuk mendapatkan fragmen DNA dari gen CAPN1 dan CAST dilakukan amplifikasi menggunakan PCR, primer, suhu annealing, panjang amplikon dapat dilihat pada tabel 1. Selain yang tertera di tabel 1, PCR juga memerlukan enzim taq DNA polimerase beserta bufernya dan campuran  dNTP mix (dATP, dGTP, dCTP, dan dTTP) konsentrasi sebesar 200 μM.

Tabel 1. Bahan yang diperlukan untuk PCR

Gen

Primer

Suhu annealing

Panjang amplikon

Enzim restriksi

Pustaka

CAPN1

forward: CCAGGGCCAGATGGTGAA

62,5 °C

709 bp

BtgI

(Corva et al. 2007)

reverse: CGTCGGGTGTCAGGTTGC

CAST

forward:AATTTTTAAAAATTGCCTTCAGTTGGGAG

62 °C

275 bp

Tsp5091

reverse:AAGAAACATCAAACACAGTCCACAAGTCTA

 

 

 

 

Metode Genotiping

Genotiping adalah kegiatan menentukan genotipe untuk ruas DNA yang ada dalam genom inti. Pada penelitian ini menggunakan dua teknik PCR yaitu RFLP (restriction fragment length polymorphism) dan SSCP (single strand conformation polymorphism). Pada teknik PCR-RFLP kondisi pemotongan mengikuti petunjuk produsen, yaitu 2 μl produk PCR dicampur dengan 1-2 unit enzim restriksi dalam 1 x buffer dan diinkubasi pada suhu 37 °C selama semalam. Visualisasi fragmen DNA produk PCR yang telah dipotong dilakukan dengan teknik elektroforesis gel polyacrilamide gel electrophoresis (PAGE) 6% yang diikuti dengan pewarnaan perak (silver staining). Teknik PCR-SSCP setelah amplifikasi DNA dilanjutkan dengan denaturasi pada suhu 94 °C, penambahan formamida dye dan tahap elektroforesis gel poliakrilamida non denaturasi (Nataraj et al. 1999).

Analisis Data

Keragaman genotipe tiap-tiap individu dapat ditentukan dari pita-pita DNA gen yang ditemukan. Masing-masing sampel dibandingkan berdasarkan ukuran (marker) yang sama dan dihitung frekuensi alel dalam setiap lokus dan setiap populasi. 

RENCANA PENELITIAN

KEGIATAN

Bulan ke –

1

2

3

4

5

6

7

Studi Literatur

Ekstraksi dan isolasi DNA

Amplifikasi DNA

Genotiping

Analisis Data

Penulisan Hasil Penelitian

DAFTAR PUSTAKA

Adrial. 2010. Sapi Lokal Kalimantan Tengah Sumberdaya Lokal Potensi yang Belum Termanfaatkan Secara Optimal. Balai Pengkajian Teknologi Pertanian Kalimantan Tengah.

Bishop MD, Koohmaraie M, Killefer J, Kappes S. 1993. Restriction fragment length polymorphisms of the bovine calpastatin gene. J Anim Sci 71:2277.

Corva P et al. 2007. Association of CAPN1 and CAST gene polymorphisms with meat tenderness in Bos taurus beef cattle from Argentina. Genetics and molecular Biology 30:1064-1069.

Goll DE, Thompson VF, Taylor RG, Christiansen JA. 1992. Role of the calpain system in muscle growth. Biochimie 74:225-237.

Huitema H. 1986. Peternakan di Daerah Tropis; Arti Ekonomi dan Kemampuannya, Penelitian di Beberapa Daerah di Indonesia. Terjemahan: Peni Hardjosworo. Jakarta: Yayasan Obor Indonesia.

Koohmaraie M, Shackelford SD, Wheeler TL, Lonergan SM, Doumit ME. 1995. A muscle Hypertrophy condition in lamb (callipyge): characterization of effects on muscle growth and meat quality traits. J Anim Sci 73:3596-3607.

Nataraj AJ, IO Gilander, N Kusukawa, WE Highsmith. 1999. Single strand conformation polymorphism and heteroduplex analysis for gel-based mutation detection. WILEY-VCH Verlag GmbH. Weinheim.

Page BT et al. 2002. Evaluation of single-nucleotide polymorphisms in CAPN1 for association with meat tenderness in cattle. J Anim Sci 80:3077-3085.

Schenkel FS et al. 2006. Association of a single nucleotide polymorphism in the calpastatin gene with carcass and meat quality traits of beef cattle. J Anim Sci 84:291-299.

No Comment

Comments are closed.