Kolokium Departemen Biologi FMIPA IPB: Muhammad Abduh

Muhamad Abduh (G34090021), Achmad Farajallah dan . Kanthi Arum Widayati. 2012. Deteksi ulang hibrid L4M5 dari Gen Opsin L dan opsin M pada Macaca fascicularis. Makalah Kolokium Departemen Biologi FMIPA IPB, Bogor 

PENDAHULUAN

Latar Belakang

Penglihatan warna trikromatik sangat penting bagi keberhasilan hidup monyet dunia lama (Old World Monkey). Penglihatan warna ini membantu primata untuk dapat membedakan antara buah dan daun (Regan et al. 1998) atau membedakan antara daun muda dengan daun tua (Dominy & Lucas 2001). Penglihatan trikromatik dibentuk oleh tiga sel kerucut (opsin) yang berbeda. Masing-masing opsin memiliki fotoreseptor yang berbeda sensitifitasnya terhadap panjang gelombang tertentu. Opsin S sensitif pada panjang gelombang 420 nm, Opsin M sensitif pada panjang gelombang 530 nm, dan Opsin L sensitif pada panjang gelombang 563nm (Bowmaker 1998).

Masing-masing opsin disandikan oleh gen yang berbeda. Opsin S disandikan oleh gen opsin S yang terletak pada kromosom ketujuh, Opsin L disandikan oleh gen opsin L dan opsin M disandikan oleh gen opsin M. Gen opsin L dan M terletak secara berurutan di kromosom X. Gen opsin L dan M memiliki 98% kemiripan pada tingkat nukleotida. Hal ini memungkinkan terjadinya pindah silang antar ruas keduanya  selama meiosis. Mutasi pada kedua gen ini dapat menyebabkan delesi pada gen opsin L dan/atau M. Tidak munculnya gen opsin L dan/atau M atau munculnya gen hibrid menyebabkan penglihatan dikromatik, atau biasa disebut buta warna (Onishi et al 1999, Onishi et al 2000).

Buta warna pada monyet dunia lama hanya ditemukan pada Macaca fascicularis. M. fascicularis yang memiliki penglihatan dikromatik hanya memiliki gen S dan gen hibrid L4M5. Sampai saat ini belum ada penelitian tentang keberadaan Macaca fascicularis yang memiliki penglihatan dikromatik setelah Onishi et al. (2002). Oleh karena itu, penelitian ini bertujuan untuk mendeteksi kembali hibrid L4M5 pada M. fascicularis.

BAHAN DAN METODE

Waktu dan Tempat. Penelitian ini akan dilaksanakan pada bulan Januari 2013 sampai Juni 2013 di bagian Fungsi Hayati dan Perilaku Hewan Departemen Biologi.

 

Koleksi Feses. Sampel feses segar akan dikoleksi dari lapang. Feses segar disimpan dalam tabung yang berisi alkohol 70% yang mengandung EDTA  1 mM.

Ekstraksi DNA. DNA akan diekstraksi dan diisolasi dari sel-sel epitel saluran pencernaan yang ada dalam feses M. fascicularis dengan menggunakan DNA Extraction Kit for Faecal Sampele.

Deteksi Hibrid L4M5. Deteksi hibrid L4M5 dari gen opsin L dan M pada M. fascicularis akan dilakukan menggunakan pendekatan amplifikasi in vitro PCR. Strategi PCR dilakukan berdasarkan lokasi gen opsin di kromoson X dan kemiripan gen opsin L dan M. Strategi pertama, ekson 5 dari gen opsin L dan opsin M diamplifikasi dengan primer forward 5’-AAAGTCGACGAATCCACCCAGAAG GCAGAG dan primer reverse 5’-ATAGGATCCGGGGTTGTAGATAGTGGCACT.. PCR mixture (25 µL) akan dibuat dengan komposisi 200 ng DNA genom, 5pmol primer forward dan reverse, dan1 unitDNA polimerase beserta sistem bufernya. Amplifikasi akan dilakukan dengan mesin PCR dengan pengaturan suhu 940C 10 menit, 940C 30 detik, 600C 30 detik, 720C 30 detik, dan 720 10 menit sebanyak 40 siklus.  Amplikon gen opsin L mempunyai situs restriksi MboI sedangkan gen opsin M tidak. Gen opsin normal akan menghasilkan pemotongan MboI berukuran 670 bp (gen opsin M), 490 bp dan 180 bp (gen opsin L). Jika terjadi delesi gen opsin M maka hasil pemotongan adalah 490 bp dan 180 bp, sedanngkan jika terjadi delesi gen opsin L maka hasil pemotongan adalah 670 bp atau tidak terjadi pemotongan. Strategi ini bisa dilakukan pada individu dengan kromosom X tunggal atau jenis kelamin jantan. Untuk individu dengan kromosom X ganda (jenis kelamin betina) maka strategi PCR kedua akan diaplikasikan, yaitu dengan desain primer untuk ekson 4-5 pada gen opsin L dan M. Ex4R (forward): 5’-GTCCTCATGGTCACCTGCTGCATCATTCCACTGGCT dan Ex5R (reverse): 5’-GGTGTAGGGTCCCCAGCAGACGCAGTATGCGAAGAT’ spesifik untuk ekson 4-5 pada gen L. Ex4G: 5’-GTCCTCATGG TCACCTGCTGCATCACCCCACTCACC Ex5G: 5’-GGTGTAGGGTCCCCAGCAGAAGCAGAA CGCCAGGAA spesifik untuk ekson 4-5 pada gen M. PCR mixture sama dengan sebelumnya dengan pengaturan suhu amplifikasi 940C 10 menit, 940C 30 detik, 650C 30 detik, 720C 1,5 menit, dan 720 10 menit sebanyak 40 siklus.

Amplikon dari setiap pasang primer adalah 1.6 kb. Jika pasangan  primer Ex4R-Ex5R dan Ex4G-Ex5G menunjukkan adanya produk PCR maka saampel mempunyai gen normal.. Produk PCR dari primer Ex4R-Ex5G menunjukkan gen hibrid L4M5. Produk PCR dari primer Ex4R-Ex5R, Ex4G-Ex5G, dan Ex4R-Ex5G menunjukkan gen carier hibrid L4M5. .

DAFTAR PUSTAKA

Bowmaker JK. 1998. Visual pigments and molecular genetics of color blindness. News Physiol. Sci 13: 63-69.

Dominy NJ. Lucas PW. 2001. Ecological importance of trichromatic vision to primates.     Nature 410:     363-366.

Nei M. 1987. Molecular Evolutionary Genetics. New York: Columbia University Press.

Onishi et al. 1999. Dichromatism in Macaque monkeys. Nature 402: 139-140.

Onishi et al. 2002. Variations in long and middle wavelength- sensitive opsin gene loci in crab eating monkeys. Vision Research 42: 281-292

Regan et all. 1998.  Frugivory and colour vision in Alouatta seniculus, a trichromatic platyrrhine monkey. Vision Research 38:3321-3327.

No Comment

Comments are closed.